Get Adobe Flash player

Hệ thống đánh dấu mã vạch DNA mini để xác thực các sản phẩm các đã qua chế biến. Phần 6

Vật liệu và Phương pháp

Chiến lược Tối ưu hóa PCR mã vạch mini. Các điều kiện khuếch đại đối với tất cả các bộ mồi đã được thử nghiệm bằng cách sử dụng một phương pháp tiếp cận PCR độ dốc trong khoảng nhiệt độ ủ lớn (43-60°C). Thành phần của các phản ứng khuếch đại, các điều kiện khuếch đại PCR (trừ nhiệt độ ủ), và các điều kiện sắp xếp chuỗi giống như những gì được sử dụng trước đây để khuếch đại và lập trình tự chuỗi của mã vạch đủ dài. Nhiệt độ ủ tối ưu của mỗi mồi được xác định dựa trên các kết quả của quá trình

điện di gel của các sản phẩm PCR theo nhiệt độ và được liệt kê trong Bảng 1. Các bước khuếch đại và mã hóa mã vạch mini được thực hiện trên DNA từ 44 sản phẩm cá thương mại sử dụng mỗi trong số sáu bộ mồi mã vạch mini. Các khoảng trống thuốc thử và kiểm soát PCR không phải mẫu được bao gồm trong tất cả các thí nghiệm PCR và sắp xếp chuỗi. Việc chỉnh sửa chuỗi và sắp xếp các mã vạch được tạo ra được thực hiện như mô tả đối với các mã vạch đủ dài sử dụng CodonCode Aligner v 3.7.1.1 (CodonCode Corp., Dedham, MA, USA). Việc xác định loài cho mỗi mẫu được tiến hành sử dụng BLAST với GenBank và một thư viện mã vạch địa phương cho các taxa được chọn với mức cắt giảm BLAST tối thiểu 98% định dạng cho một cặp hàng đầu. Các kết quả này đã được xác minh bằng phân tích kết hợp lân cận33 và đánh giá tiếp theo việc nhóm các mẫu đã được kiểm tra so với các trình tự cơ sở dữ liệu.

Bộ mồi Tên mồi Phương hướng Đoạn mồi (5′-3′) Độ dài mã vạch (bp) Nhiệt độ ủ. (°C)

Universal Fish

Fish_Univ_F Phía trước CACGACGTTGTAAAACGACACYAAICAYAAAGAYATIGGCAC 652 51
Fish_Univ_R Đảo ngược GGATAACAATTTCACACAGGACITCAGGGTGWCCGAARAAYCARAA
Mini_SH-A Fish _miniA_F_t Phía trước CACGACGTTGTAAAACGACACIAAICAIAAAGAYATYGGC 129 46
Fish _miniA_R_t Đảo ngược GGATAACAATTTCACACAGGAARAAAATYATAACRAAIGCRTGIGC
Mini_SH-B Fish _miniB_F_t Phía trước CACGACGTTGTAAAACGACGCIGGIRTYTCITCIATYYTAG 227 48
Fish _miniB_R_t Đảo ngược GGATAACAATTTCACACAGGACTTCAGGGTGICCGAARAATCA
Mini_SH-C Fish _miniC_F_t Phía trước# CACGACGTTGTAAAACGACACYAAICAYAAAGAYATIGGCAC 127 46
Fish _miniC_R_t Đảo ngược GGATAACAATTTCACACAGGGAARATCATAATGAAGGCATGIGC
Mini_SH-D Fish _miniD_F_t Phía trước* CACGACGTTGTAAAACGACGGIACIGGITGRACIGTITAYCCYCC 208 50
Fish _miniD_R_t Đảo ngược GGATAACAATTTCACACAGGGTRATICCIGCIGCIAGIAC
Mini_SH-E Fish _miniE_F_t Phía trước# CACGACGTTGTAAAACGACACYAAICAYAAAGAYATIGGCAC 226 46
Fish _miniE_R_t Đảo ngược GGATAACAATTTCACACAGGCTTATRTTRTTTATICGIGGRAAIGC
Mini_SH-F Fish _miniF_F_t Phía trước* CACGACGTTGTAAAACGACGGIACIGGITGRACIGTITAYCCYCC 314 49
Fish _miniF_R_t Đảo ngược GGATAACAATTTCACACAGGCTTCAGGGTGICCGAARAATC
M13 M13F (-21) Phía trước CACGACGTTGTAAAACGAC NA NA
M13R (-27) Đảo ngược GGATAACAATTTCACACAGG

 

 

Bảng 1. Khuếch đại PCR và sắp xếp trình tự mồi được sử dụng để tạo mã vạch mini DNA của các sản phẩm cá chế biến. # Các chuỗi chuyển tiếp dùng cho bộ mồi C tương tự như trình tự chuyển tiếp cho bộ mồi E * Chuỗi chuyển tiếp cho bộ mồi F cũng giống như chuỗi chuyển tiếp đối với bộ mồi D & độ dài mã vạch được tính toán mà không cần mồi khuếch đại.

 

sodo1

 

Hình 2. Biểu diễn giản đồ các khu vực được khuếch đại bởi các mồi mã vạch mini được thiết kế trong nghiên cứu này, thể hiện trong vùng mã vạch COI chuẩn.

Đoạn gen COI Kích thước (bp) Độ phân giải 100% ≤2% chênh lệch Nucleotide
Số chi

%

Số loài

%

Số chi

%

Số loài

%

Mã vạch đầy đủ 652 124 100 200 100 124 100 185 92.5
Đoạn A 129 124 100 191 95.5 122 98.4 178 89
Đoạn B 227 124 100 200 100 124 100 194 97
Đoạn  C 127 121 97.6 188 94 119 96 174 87
Đoạn D 208 124 100 200 100 124 100 192 96
Đoạn E 226 124 100 198 99 122 98.4 177 88.5
Đoạn F 314 124 100 200 100 124 100 195 97.5

Bảng 2. Trong các phân tích silico về phân loại được giải quyết bởi sáu vùng mã vạch mini khi so sánh trên 200 loài từ 124 mẫu sử dụng mã vạch DNA từ các mẫu tham chiếu FDA được chứng thực. Độ phân giải ở mức nhận dạng 98% và 100%.

Thông báo

325962